> For the complete documentation index, see [llms.txt](https://help.dragen.illumina.com/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://help.dragen.illumina.com/dragen-v4.4/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/quick-start/sample-sheet-requirements.md).

# Sample Sheet Requirements

The pipeline has fields that are required in addition to general sample sheet requirements. Follow the steps below to create a valid samplesheet.

## Standard Sample Sheet Requirements

The following sample sheet requirements describe required and optional fields for the pipeline. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.

The analysis fails if the sample sheet requirements are not met.

Use the following steps to create a valid sample sheet.

1. Download the sample sheet v2 template that matches the instrument & assay run.
2. In the Sequencing Settings section, enter the following required parameters:

### \[Sequencing\_Settings] Section

| Sample Parameter | Required | Details                                                    |
| ---------------- | -------- | ---------------------------------------------------------- |
| LibraryPrepKits  | Required | Accepted values are: IlluminaDNAPrep or IlluminaDNAPCRFree |

3. In the BCL Convert Settings section, enter the following required parameters:

### \[BCLConvert\_Settings] Section

| Sample Parameter         | Required | Details                                                                                                                                                                     |
| ------------------------ | -------- | --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| SoftwareVersion          | Required | The DRAGEN component software version. The pipeline requires `4.4.4 or higher`. To ensure you are using the latest compatible version, refer to the software release notes. |
| AdapterRead1             | Required | If using 10 bp indexes with UDP: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC Analysis fails if the incorrect adapter sequences are used                                              |
| AdapterRead2             | Required | If using 10 bp indexes with UDP: CTGTCTCTTATACACATCTGACGCTGCCGACGA Analysis fails if the incorrect adapter sequences are used                                               |
| AdapterBehavior          | Optional | Enter `trim` This indicates that the BCL Convert software trims the specified adapter sequences from each read.                                                             |
| MinimumTrimmedReadLength | Optional | Enter `35`. Reads with a length trimmed below this point are masked.                                                                                                        |
| MaskShortReads           | Optional | Enter `35`. Reads with a length trimmed below this point are masked.                                                                                                        |

4. In the BCL Convert Data section, enter the following parameters for each sample.

### \[BCLConvert\_Data] Section

| Sample Parameter | Required                                                         | Details                                                                                                                                                                                      |
| ---------------- | ---------------------------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| Sample\_ID       | Required                                                         | Must match a Sample\_ID listed in the \[Heme\_Data] section section.                                                                                                                         |
| Index            | Required                                                         | Index 1 sequence valid for Index\_ID assigned to matching Sample\_ID in the \[Heme\_Data] section.                                                                                           |
| Index2           | Required                                                         | Index 2 sequence valid for Index\_ID assigned to matching Sample\_ID in the \[Heme\_Data] section.                                                                                           |
| Lane             | Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows | Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row. |

5. In the \[Heme\_Data] section, enter the following parameters:

\[Heme\_Data] Section header changes depending on the deployment: Section header changes depending on the deployment:

* Standalone DRAGEN Server and ICA with Manual Launch: `Heme_Data`
* ICA with Auto-launch: `Cloud_Heme_Data`

### \[Heme\_Data] Section

| Sample Parameter    | Required | Details                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           |
| ------------------- | -------- | --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| Sample\_ID          | Required | <p>The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics:<br>- Unique for the run.<br>- 1–70 characters.<br>- No spaces.<br>- Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1\_022515.<br>- Cannot be called <code>all</code>, <code>default</code>, <code>none</code>, <code>unknown</code>, <code>undetermined</code>, <code>stats</code>, or <code>reports</code>.<br>- Must match a Sample\_ID listed in the \[BCLConvert\_Data] section. Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.</p> |
| Sample\_Type        | Optional | Enter `DNA`                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       |
| Case\_ID            | Optional | A unique ID that links the same biological samples from the same individual. It is used for variant interpretation in downstream software such as the Illumina Connected Insights software                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        |
| Sample\_Description | Optional | Sample description must meet the following requirements: - 1–50 characters. - Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, heme-WGS\_213.                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        |

To ensure a successful analysis, follow these guidelines:

1. Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.
2. When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name `SampleSheet.csv`, or choose a different name and specify the path in the command-line options.

## ICA with Auto-launch: Sample Sheet Requirements

Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see [Standard Sample Sheet Requirements](#standard-sample-sheet-requirements). Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template

To auto-launch analysis from the sequencer run folder, ensure the StartsFromFastq and SampleSheetRequested fields are set to FALSE. To auto-launch analysis from FASTQs after BCL Convert auto-launch, StartsFromFastq and SampleSheet Requested fields must be set to TRUE

### **\[Cloud\_Heme\_Data] Section**

Refer to [\[Heme\_Data\] Section](#heme_data-section) for this section's requirements.

### **\[Cloud\_Heme\_Settings] Section**

| Parameters           | Required     | Details                                                                                                                                                     |
| -------------------- | ------------ | ----------------------------------------------------------------------------------------------------------------------------------------------------------- |
| SoftwareVersion      | Not Required | The Heme pipeline software version                                                                                                                          |
| StartsFromFastq      | Required     | Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE. |
| SampleSheetRequested | Required     | Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE. |

### \[Cloud\_Data] Section

| Parameters          | Required     | Details                                                                                    |
| ------------------- | ------------ | ------------------------------------------------------------------------------------------ |
| Sample\_ID          | Not Required | The same sample ID used in the Cloud\_HemeS\_Data section.                                 |
| ProjectName         | Not Required | The BaseSpace project name.                                                                |
| LibraryName         | Not Required | Combination of sample ID and index values in the following format: sampleID\_Index\_Index2 |
| LibraryPrepKitName  | Required     | The Library Prep Kit used.                                                                 |
| IndexAdapterKitName | Not Required | The Index Adapter Kit used.                                                                |

### \[Cloud\_Settings] Section

| Parameter             | Required     | Details                                                                                                                                                                                                                               |
| --------------------- | ------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| GeneratedVersion      | Not Required | The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.                                                                                                                                  |
| CloudWorkflow         | Not Required | Ica\_workflow\_1                                                                                                                                                                                                                      |
| Cloud\_Heme\_Pipeline | Required     | This value is a universal record number (URN). The valid values are described in the [Release Information](/dragen-v4.4/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/quick-start.md#table-1-release-information) |
| BCLConvert\_Pipeline  | Required     | The value is a URN in the following format: urn:ilmn:ica:pipeline: \<pipeline-ID>#\<pipeline-name>                                                                                                                                    |


---

# Agent Instructions
This documentation is published with GitBook. GitBook is the documentation platform designed so that both humans and AI agents can read, navigate, and reason over technical content effectively. Learn more at gitbook.com.

## Querying This Documentation
If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter, and the optional `goal` query parameter:

```
GET https://help.dragen.illumina.com/dragen-v4.4/product-guide/dragen-v4.4/dragen-apps/dragen-heme-wgs-to-pipeline/quick-start/sample-sheet-requirements.md?ask=<question>&goal=<endgoal>
```

`ask` is the immediate question: it should be specific, self-contained, and written in natural language.
`goal` is optional and describes the broader end goal you are ultimately trying to accomplish on behalf of the user. GitBook uses it to tailor the answer towards what is most useful for that goal.

The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.
