Sample Sheet Requirements

The pipeline has fields that are required in addition to general sample sheet requirements. Follow the steps below to create a valid samplesheet.

Standard Sample Sheet Requirements

The following sample sheet requirements describe required and optional fields for the pipeline. Depending on the deployment (standalone DRAGEN server, ICA with auto-launch, ICA with manual launch), certain sections and required values can deviate from the standard requirements. These deviations are noted in the information below.

The analysis fails if the sample sheet requirements are not met.

Use the following steps to create a valid sample sheet.

1. Download the sample sheet v2 template that matches the instrument & assay run.

2. In the Sequencing Settings section, enter the following required parameters:

[Sequencing_Settings] Section

Sample Parameter	Required	Details
LibraryPrepKits	Required	Accepted values are: IlluminaDNAPrep or IlluminaDNAPCRFree

1. In the BCL Convert Settings section, enter the following required parameters:

[BCLConvert_Settings] Section

Sample Parameter	Required	Details
SoftwareVersion	Required	The DRAGEN component software version. The pipeline requires 4.4.4 or higher. To ensure you are using the latest compatible version, refer to the software release notes.
AdapterRead1	Required	If using 10 bp indexes with UDP: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC Analysis fails if the incorrect adapter sequences are used
AdapterRead2	Required	If using 10 bp indexes with UDP: CTGTCTCTTATACACATCTGACGCTGCCGACGA Analysis fails if the incorrect adapter sequences are used
AdapterBehavior	Optional	Enter trim This indicates that the BCL Convert software trims the specified adapter sequences from each read.
MinimumTrimmedReadLength	Optional	Enter 35. Reads with a length trimmed below this point are masked.
MaskShortReads	Optional	Enter 35. Reads with a length trimmed below this point are masked.

1. In the BCL Convert Data section, enter the following parameters for each sample.

[BCLConvert_Data] Section

Sample Parameter	Required	Details
Sample_ID	Required	Must match a Sample_ID listed in the [Heme_Data] section section.
Index	Required	Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the [Heme_Data] section.
Index2	Required	Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the [Heme_Data] section.
Lane	Only for NovaSeq 6000 XP, NovaSeq 6000Dx, or NovaSeq X workflows	Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Cannot be empty, i.e the analysis fails if the Lane column is present without a value in each row.

1. In the [Heme_Data] section, enter the following parameters:

[Heme_Data] Section header changes depending on the deployment: Section header changes depending on the deployment:

• Standalone DRAGEN Server and ICA with Manual Launch: Heme_Data

• ICA with Auto-launch: Cloud_Heme_Data

[Heme_Data] Section

Sample Parameter	Required	Details
Sample_ID	Required	The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics: - Unique for the run. - 1–70 characters. - No spaces. - Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515. - Cannot be called all, default, none, unknown, undetermined, stats, or reports. - Must match a Sample_ID listed in the [BCLConvert_Data] section. Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.
Sample_Type	Optional	Enter DNA
Case_ID	Optional	A unique ID that links the same biological samples from the same individual. It is used for variant interpretation in downstream software such as the Illumina Connected Insights software
Sample_Description	Optional	Sample description must meet the following requirements: - 1–50 characters. - Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, heme-WGS_213.

To ensure a successful analysis, follow these guidelines:

1. Avoid any blank lines at the end of the sample sheet; these can cause the analysis to fail.

2. When running local analysis using the command line save the sample sheet in the sequencing run folder with the default name SampleSheet.csv, or choose a different name and specify the path in the command-line options.

ICA with Auto-launch: Sample Sheet Requirements

Refer to the following requirements to create sample sheets for running the analysis on ICA with Auto-launch. For sample sheet requirements common between deployments see Standard Sample Sheet Requirements. Samples sheets can be created using BaseSpace Run Planning Tool or manually by downloading and editing a sample sheet template

To auto-launch analysis from the sequencer run folder, ensure the StartsFromFastq and SampleSheetRequested fields are set to FALSE. To auto-launch analysis from FASTQs after BCL Convert auto-launch, StartsFromFastq and SampleSheet Requested fields must be set to TRUE

[Cloud_Heme_Data] Section

Refer to [Heme_Data] Section for this section's requirements.

[Cloud_Heme_Settings] Section

Parameters	Required	Details
SoftwareVersion	Not Required	The Heme pipeline software version
StartsFromFastq	Required	Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.
SampleSheetRequested	Required	Set the value to TRUE or FALSE. To auto-launch from BCL files, set to FALSE. To auto-launch from FASTQ files after auto-launch of BCL Convert, set to TRUE.

[Cloud_Data] Section

Parameters	Required	Details
Sample_ID	Not Required	The same sample ID used in the Cloud_HemeS_Data section.
ProjectName	Not Required	The BaseSpace project name.
LibraryName	Not Required	Combination of sample ID and index values in the following format: sampleID_Index_Index2
LibraryPrepKitName	Required	The Library Prep Kit used.
IndexAdapterKitName	Not Required	The Index Adapter Kit used.

[Cloud_Settings] Section

Parameter	Required	Details
GeneratedVersion	Not Required	The cloud GSS version used to create the sample sheet. Optional if manually updating a sample sheet.
CloudWorkflow	Not Required	Ica_workflow_1
Cloud_Heme_Pipeline	Required	This value is a universal record number (URN). The valid values are described in the Release Information
BCLConvert_Pipeline	Required	The value is a URN in the following format: urn:ilmn:ica:pipeline: <pipeline-ID>#<pipeline-name>